Can the Irrationality in Mathematics be Explained by Genetic Codes Expressed in the Square Root of the Number Ten?

Abstract

This article investigates whether there is a connection between the square root of ten, which is one of the irrational numbers, and genetic sequences. First, the square root digits of the number ten after the comma are subjected to an individual addition operation. Secondly, the result of the addition corresponds to the nucleotide bases. Thirdly, the results obtained in this way are expressed as nucleotide bases (A, T, C and G) [(A) Adenine, (T) Thymine, (C) Cytosine and (G) Guanine]. From this point of view, approximately when the first four hundred digits of the square root of the number ten after the comma are calculated [1], the resulting gene sequencing is as follows: [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. Fourthly, at the same time some repetitions exactly like this were detected.: as”AGT” and “ATA”. Fifthly, after searching this sequence in NCBI (National Biotechnology Information Center), the search result was similar to bony fish, especially Danio Aesculapii [2]. Finally, the species Danio Aesculapii [3] is closely related to the Zebrafish. In summary, With these results, not only the square root of ten in mathematics, but many more irrational numbers (as explained by the similar QUANTUM PERSPECTIVE MODEL in previous articles; See Table-2) to give a common perspective on these different sciences; the link between genetic codes in biochemistry and irrational numbers in mathematics has shown to be significant and has revealed very valuable results. In other words, with this original research, a new window has been opened that can lead to new interdisciplinary discoveries.